Scripts and workflows for the assembly, polishing, quality assessment, and visualization of complete cyanobacterial genomes.
This repository contains step-by-step protocols and scripts for generating high-quality cyanobacterial genome assemblies from sequencing data. The workflow covers hybrid assembly, contig circularization, quality evaluation, sequence annotation, and multiple visualization approaches commonly used in comparative and structural genomics.
$ head Limnothrix_sp_HT2024_plasmid_GENOME.yaml
fasta:
class: File
location: Limnothrix_sp_HT2024_plasmid_GENOME.fasta
submol:
class: File
location: Limnothrix_sp_HT2024_plasmid_SUBMOL_PRE.yaml
$ head Limnothrix_sp_HT2024_plasmid_SUBMOL_PRE.yaml
topology: 'circular'
location: plasmid
organism:
genus_species: 'Limnothrix sp.'
strain: 'HorseThiefRes_Aug2024'
contact_info:
last_name: 'Michael'
first_name: 'Gruenstaeudl'
email: 'm_gruenstaeudl@fhsu.edu'
organization: 'Fort Hays State University'
$ head Limnothrix_sp_HT2024_plasmid_GENOME.fasta
>Limnothrix sp. HorseThiefRes_Aug2024 plasmid, complete sequence [plasmid-name=unnamed]
ATGCCTGTGCAGGACACAGACGAGGCTATACCTGTCAGTGTACCTGAATCCTCGAATTCC
TCAATCCCATTAGCTGAGGTCTCACCCCGAGACAAGCCGTGGGATAAGCATCGCGCTAAT
...
$ pgap.py -r Limnothrix_sp_HT2024_plasmid_GENOME.yaml
Output will be placed in: /mnt/c/Users/m_gruenstaeudl/OneDrive - Fort Hays State University/Desktop/temp/plasmid/output
PGAP version 2025-05-06.build7983 is up to date.
PGAP completed successfully.Merging PAGP-generated and own annotations
python Step4__Merge_GenBank_tags.py \
Limnothrix_sp_HT2024_plasmid_PGAP.gbk \
Limnothrix_sp_HT2024_plasmid_GENOME.gb \
Limnothrix_sp_HT2024_plasmid_MERGED.gb# Bacterial genome
python Step1__PYSCRIPT_Evaluate_reading_frames_of_genes.py -i Limnothrix_sp_HT2024_Bactopia.gb -o Limnothrix_sp_HT2024_Bactopia_ANNOTATION-INFO
# Bacterial plasmid
python Step1__PYSCRIPT_Evaluate_reading_frames_of_genes.py -i Limnothrix_sp_HT2024_plasmid.gb -o Limnothrix_sp_HT2024_plasmid_ANNOTATION-INFO# Bacterial genome
python Step2__PYSCRIPT_Compare_genes_by_name_and_position.py Limnothrix_sp_HT2024_Bactopia.gb Limnothrix_sp_HT2024_bacass.gb --max-start-diff 500- Standardize the annotations of a bacterial genome
This script ensures that every
CDSand everygeneannotation contain at least agene-tag as well as aproduct-tag. Thegene-tag contains the four-letter gene abbreviation. The full behaviour of the script is as follows:
# Bacterial genome
python Step3__PYSCRIPT_Standardize_annotations_of_bacterial_genome.py input.gb output.gb
grep -v '/gene="unknown_gene"' output.gb | grep -v "/locus_tag=" > output_final.gb
# Bacterial plasmid
python Step3__PYSCRIPT_Standardize_annotations_of_bacterial_genome.py Limnothrix_sp_HT2024_plasmid.gb Limnothrix_sp_HT2024_plasmid_TMP.gb
grep -v '/gene="unknown_gene"' Limnothrix_sp_HT2024_plasmid_TMP.gb | grep -v "/locus_tag=" > Limnothrix_sp_HT2024_plasmid_FINAL.gb| Situation | Action | Log style |
|---|---|---|
CDS already has valid gene and product |
Copy missing values to the paired gene feature; CDS remains authoritative |
White if nothing changes, yellow if synchronization changes something |
Only the gene feature has valid gene and product |
Copy missing values to the paired CDS feature |
Yellow if this changes the CDS, otherwise white |
gene and CDS disagree |
Prefer CDS values and record the conflict in the report | Yellow if resolved successfully, red if still unresolved |
Valid product exists but gene is missing |
Try local mapping first; otherwise query UniProt cyanobacteria by product to infer the most common gene abbreviation | Yellow on successful resolution, red on failure |
Valid gene exists but product is missing |
Try local mapping first; otherwise query UniProt cyanobacteria by gene to infer the most common product description | Yellow on successful resolution, red on failure |
standard_name is present |
Use it as supporting information during local resolution and as the displayed name in logs | Shown as standard_name instead of locus_tag |
standard_name is hypothetical protein CDS or hypothetical protein gene |
Do not query UniProt and do not log the annotation; still standardize /product to hypothetical protein |
No log output |
Product is already hypothetical protein for one of those hypothetical-standard-name annotations |
Leave it as hypothetical protein or rewrite it to the same standard form |
No log output |
| Nothing reliable can be inferred | Fall back to unresolved values such as unknown_gene or remaining missing information, and record it in the report |
Red |
| Annotation does not change | Keep existing values as they are | White |
| Priority | Rule |
|---|---|
| 1 | Prefer existing CDS qualifiers over gene qualifiers |
| 2 | Copy missing values across paired gene and CDS features |
| 3 | Apply the local mapping table |
| 4 | Query UniProt cyanobacteria by product if gene is missing |
| 5 | Query UniProt cyanobacteria by gene if product is missing |
| 6 | Skip logging and UniProt lookup for annotations whose standard_name is hypothetical protein CDS or hypothetical protein gene, but still standardize their product to hypothetical protein |
| 7 | Record conflicts and unresolved cases in the report |
| Metric | HorseThief_lake_water_2 | HorseThief_in_cultivation |
|---|---|---|
| Raw reads | 54,376 | 91,377 |
| ASV method | DADA2 | DADA2 |
| Number of ASVs | 201 | 272 |
| Number of genera | 53 | 67 |
| Number of families | 40 | 46 |
| Shannon diversity | 6.570 | 6.341 |
| Pielou evenness | 0.859 | 0.784 |
| Simpson diversity | 0.983 | 0.972 |
- Image files are stored in the corresponding
data_STEPXX__*directories. - All workflows assume Linux environments and standard bioinformatics toolchains.
- Individual steps can be adapted to other bacterial genomes with minimal modification.