[readme] update

Author: progistar

README.md

@@ -153,7 +153,6 @@ PepQueryMHC provides four modes (scan, fastq, target, and annotate modes) and ge
 This format is generated in both scan and fastq modes and contains detailed level of transcriptomic features.<br>
 | Column                            | Description                                                                       | Example                     |  Scan mode   | FASTQ mode |
 | :---:                             | :---:                                                                             | :---:                       | :---:        | :---:      |
-| Sequence                          | Input peptide sequence                                                            | LLAETKIHL                   |  Y           | Y          |
 | Matched_location                  | Matched genomic location                                                          | chr16:84101848-84101874     |  Y           | N          |
 | Matched_mutations                 | Nucleotide variants including SNV and INDEL                                       | chr16:84101848A>T           |  Y           | N          |
 | Matched_strand                    | RNA strand                                                                        | -                           |  Y           | N          |
@@ -165,7 +164,19 @@ This format is generated in both scan and fastq modes and contains detailed leve
 | Proportion                        | Proportion of this annotation among all reads matching the input peptide sequence | 0.947916666666666           |  Y           | Y          |
 
 ### target.tsv
-This format is generated by target mode.<br>
+This format is generated in target mode.<br>
+| Column                            | Description                                                                       | Example                     |
+| :---:                             | :---:                                                                             | :---:                       |
+| Matched_location                  | Matched genomic location                                                          | chr16:84101848-84101874     |
+| Matched_mutations                 | Nucleotide variants including SNV and INDEL                                       | chr16:84101848A>T           |
+| Matched_strand                    | RNA strand                                                                        | -                           |
+| Matched_peptide                   | Translated nucleotide sequence directly from the input NGS                        | LLAETKIHL                   |
+| Matched_nucleotide                | Nucleotide sequence directly from the input NGS                                   | TAAGTGAATTTTTGTTTCAGCTAAAAG |
+| Matched_reference_nucleotide      | Reference nucleotide sequence of a given genomic region                           | aAAGTGAATTTTTGTTTCAGCTAAAAG |
+| Matched_read_count                | The number of reads supporting the match                                          | 91                          |
+| Matched_RPHM                      | Normalized read count supporting tha match                                        | 32.6392389935464            |
+| Proportion                        | Proportion of this annotation among all reads matching the input peptide sequence | 0.978494623655914           |
+
 
 ### gloc.tsv
 This format is generated in both scan and target modes. It summarizes matches at the genomic location level, regardless of mutations<br>